RegulonDB RegulonDB 11.2: Operon Form
   

gadEF-mdtEF operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: gadEF-mdtEF
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: gadEF
Gene(s): gadE, gadF   Genome Browser M3D Gene expression COLOMBOS
Note(s): Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009
The expression of the gene gadE is increased under acidic growth conditions in microaerobiosis Marzan LW,2013
The expression of gadE appears to be slightly repressed by Rob under butanol stress Wang Z,2020.
Promoter
Name: gadEp3
+1: 3657800
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 566
Sequence: ttagccatttcaaacattatcatggctgatattttccgtagtcaggtttaatgttttaaaAgtgctgtgggaaagtgaaca
                      -35                        -10        +1                   
Note(s): Based on Northern blotting analysis, the gadEp2 (T2 mRNA) promoter was identified by Sayed and Foster in 2009 Sayed AK,2009 However, using different techniques, such as RNase-deficient, translational funtions, luciferase assay, and RT-PCR, it was determined that the 5'end at -324 (T2 mRNA) was monophosphoryled; it was also shown that T2 mRNA was generated from T3 mRNA via RNA processing, so that gadEp2 was removed Aiso T,2014
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[EXP-IEP]
[RS-EPT-CBR]
Reference(s): [1] Huerta AM., et al., 2003
[2] Salgado H, et al., 2012
[3] Sayed AK., et al., 2009
TF binding sites (TFBSs)
[ArcA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd ArcA-phosphorylated activator gadEp3 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [10]
[GadX,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadX activator gadEp3 3657740 3657759 -50.5 ctatggcaaaTTAGCCATTTCAAACATTATcatggctgat nd [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] S [3], [5], [6], [7], [8]
proximal GadX activator gadEp3 3657761 3657780 -29.5 aaacattatcATGGCTGATATTTTCCGTAGtcaggtttaa nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] S [3], [5], [6], [7], [8]
[YdeO,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal YdeO activator gadEp3 3657746 3657772 -41.0 caaattagccATTTCAAACATTATCATGGCTGATATTttccgtagtc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [3], [9]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA ArrS gadEF activator 3657986 3658054 AAAGAAAGCUGGCAAUCCAAUUGCCAGCUUAAGUCGAAACAAGGAGACUCGAUAUUUAAAUCGGAUUAC nd [EXP-IEP] [4]


Transcription unit       
Name: gadE-mdtEF
Gene(s): gadE, gadF, mdtE, mdtF   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of gadE appears to be slightly repressed by Rob under butanol stress Wang Z,2020.
Reference(s): [11] Hirakawa H., et al., 2006
Promoter
Name: gadEp4
+1: 3658062
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 304
Sequence: ccaattgccagcttaagtcgaaacaaggagactcgatatttaaatcggattacattttaaCtttagtaatattcttcagag
                          -35                      -10      +1                   
Evidence: [COMP-AINF]
[COMP-HINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Huerta AM., et al., 2003
[12] Itou J., et al., 2009


Transcription unit          
Name: gadEF
Gene(s): gadE, gadF   Genome Browser M3D Gene expression COLOMBOS
Note(s): The transcription of gadE appears to be increased under acidic growth conditions during stationary and exponential phases in an RcsB-dependent manner Johnson MD,2011 However, it is not known which of the five promoters that transcribe this gene is affected by RcsB. The expression of gadE is also increased under acidic growth conditions in microaerobiosis Marzan LW,2013 Based on overproduction of BglG in stationary phase, it was determined that BglG positively regulates gadE through an independent and unknown mechanism Shukla S,2019
The expression of gadE appears to be slightly repressed by Rob under butanol stress Wang Z,2020.
Promoter
Name: gadEp1
+1: 3658242
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 124
Sequence: ttaggatcaatatatggagtgcgtgatggataaatctgaagtattgattagtgttaatagAcgtattagttcacgaagggt
                           -35              -10             +1                   
Note(s): The gadEp1 (T1 mRNA) could be the result of RNA processing from gadEp3 (T3 mRNA), because it has a monophosphate at the 5'-end Aiso T,2014
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[EXP-IEP]
Reference(s): [13] Hommais F., et al., 2004
[1] Huerta AM., et al., 2003
[3] Sayed AK., et al., 2009
TF binding sites (TFBSs)
[ArcA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd ArcA-phosphorylated activator gadEp1 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [10]
[GadE,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadE activator gadEp1 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [3]
[PhoP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PhoP-phosphorylated activator gadEp1 3658149 3658165 -85.0 ttttgtttgcTATTTACAAGCTGATAAcaaccaggaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [14]


Transcription unit          
Name: gadEF-mdtEF
Gene(s): gadE, gadF, mdtE, mdtF   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of the mdtF gene, and probably the expression of the complete gadEF-mdtEF operon, is affected by the antibiotic pressure. An increase in the mdtF expression is maintained during exposition to increasing concentrations of tetracycline Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007
Purified GadX was shown to bind between the -360 and -804 regions upstream of gadE. It activates its expression during the stationary phase. However, the specific position with respect to the transcriptional start site of gadE was not determined Sayed AK,2007.
GadW was shown to bind between the -360 and -804 regions upstream of gadE, activating its expression during the stationary phase. Sayed AK,2007
Overexpression of GadX activates expression of the mdtEF operon, causing multidrug resistance Nishino K,2008. Induction of the mdtE gene by indole is independent of the EvgSA two-component signal transduction system that regulates the mdtE gene, but mdtE induction is mediated by GadX Hirakawa H,2005.
gadE expression is strongly induced by GreA overproduction only when DksA is absent, as are many other genes Vinella D, Potrykus K, Murphy H, Cashel M,2012. The expression of this gene is also increased under acidic growth conditions in microaerobiosis Marzan LW,2013
Anaerobic expression of the gadEF-mdtEF operon is primarily regulated by the two-component system ArcBA through antagonism of H-NS-mediated repression Deng Z,2013
The expression of gadE appears to be slightly repressed by Rob under butanol stress Wang Z,2020.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [11] Hirakawa H., et al., 2006
Promoter
Name: gadEp2
+1: 3658345
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 21
Sequence: atattgaacaacgattcggacaaggatgtaaataatgaaaaggatgacatattcgaaacgAtaacggctaaggagcaagtt
                                  -35             -10       +1                   
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Huerta AM., et al., 2003
[15] Ma Z., et al., 2004
TF binding sites (TFBSs)
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP repressor gadEp2 3658315 3658336 -19.5 caaggatgtaAATAATGAAAAGGATGACATATtcgaaacgat nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [11]
[EvgA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd EvgA-phosphorylated activator gadEp2 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [15]
[FliZ,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FliZ repressor gadEp2 3658325 3658383 9.5 aataatgaaaAGGATGACATATTCGAAACGATAACGGCTAAGGAGCAAGTTATGATTTTTCTCATGACGaaagattctt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [16]
[GadE,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GadE activator gadEp2 3658137 3658156 -198.5 caaacgttaaCTTTTTGTTTGCTATTTACAagctgataac nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [15]
proximal GadE activator gadEp2 3658272 3658291 -63.5 taaagttcttATAGGCGTTTACTATATTGAacaacgattc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [15]
proximal GadE activator gadEp2 3658305 3658324 -30.5 acgattcggaCAAGGATGTAAATAATGAAAaggatgacat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [15]
[GadW,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GadW activator gadEp2 3657740 3657759 -595.5 ctatggcaaaTTAGCCATTTCAAACATTATcatggctgat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [6], [7]
remote GadW activator gadEp2 3657761 3657780 -574.5 aaacattatcATGGCTGATATTTTCCGTAGtcaggtttaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [6], [7]
[GadX,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GadX activator gadEp2 3657740 3657759 -595.5 ctatggcaaaTTAGCCATTTCAAACATTATcatggctgat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [3], [5], [6], [7], [8]
remote GadX activator gadEp2 3657761 3657780 -574.5 aaacattatcATGGCTGATATTTTCCGTAGtcaggtttaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [3], [5], [6], [7], [8]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor gadEp2 nd nd nd nd nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [17]
[YdeO,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd YdeO activator gadEp2 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [15]


Transcription unit       
Name: mdtEF
Gene(s): mdtE, mdtF   Genome Browser M3D Gene expression COLOMBOS
Note(s): mdtE expression is increased at least 5-fold by indole Hirakawa H,2005.
ZraR activates mdtE expression Rome K,2018
The mdtEF-tolC, malEFG, gadBC, treBC, entCEBA-ybdB, hdeAB-yhiD, and alaE operons were differentially regulated after induction of the nonnative organic acid citramalate Webb J,2019
Evidence: [COMP-AINF] Inferred computationally without human oversight
[IC-ADJ-GENES-SAME-BIO-PROCESS] Products of adjacent genes in the same biological process
Promoter
Name: mdtEp1
+1: 3659084
Distance from start of the gene: 148
Sequence: gaacccttcgttgcccgaatgctggcaggaactgttggcagaacggcaacattttttttgTcgttgacctcaccatgtcga
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [18] Eguchi Y., et al., 2003


Transcription unit       
Name: mdtEF
Gene(s): mdtE, mdtF   Genome Browser M3D Gene expression COLOMBOS
Evidence: [COMP-AINF] Inferred computationally without human oversight
[IC-ADJ-GENES-SAME-BIO-PROCESS] Products of adjacent genes in the same biological process
Promoter
Name: mdtEp2
+1: 3659140
Distance from start of the gene: 92
Sequence: tttgtcgttgacctcaccatgtcgatcactgtgcctgtatcccaccttactggctgacaaCcccactatgccgctggtctg
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [18] Eguchi Y., et al., 2003


Transcription unit       
Name: mdtEF
Gene(s): mdtE, mdtF   Genome Browser M3D Gene expression COLOMBOS
Evidence: [COMP-AINF] Inferred computationally without human oversight
[IC-ADJ-GENES-SAME-BIO-PROCESS] Products of adjacent genes in the same biological process
Promoter
Name: mdtEp3
+1: 3659145
Distance from start of the gene: 87
Sequence: cgttgacctcaccatgtcgatcactgtgcctgtatcccaccttactggctgacaaccccaCtatgccgctggtctgtaaat
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [18] Eguchi Y., et al., 2003


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IEP] Inferred from expression pattern

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [COMP-HINF] Inferred by a human based on computational evidence

 [COMP-HINF-POSITIONAL-IDENTIFICATION] Human inference of promoter position

 [EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [3] Sayed AK., Foster JW., 2009, A 750 bp sensory integration region directs global control of the Escherichia coli GadE acid resistance regulator., Mol Microbiol 71(6):1435-50

 [4] Aiso T., Kamiya S., Yonezawa H., Gamou S., 2014, Overexpression of an antisense RNA, ArrS, increases the acid resistance of Escherichia coli., Microbiology 160(Pt 5):954-61

 [5] Nishino K., Senda Y., Yamaguchi A., 2008, The AraC-family regulator GadX enhances multidrug resistance in Escherichia coli by activating expression of mdtEF multidrug efflux genes., J Infect Chemother 14(1):23-9

 [6] Sayed AK., Odom C., Foster JW., 2007, The Escherichia coli AraC-family regulators GadX and GadW activate gadE, the central activator of glutamate-dependent acid resistance., Microbiology 153(Pt 8):2584-92

 [7] Tramonti A., De Canio M., De Biase D., 2008, GadX/GadW-dependent regulation of the Escherichia coli acid fitness island: transcriptional control at the gadY-gadW divergent promoters and identification of four novel 42 bp GadX/GadW-specific binding sites., Mol Microbiol 70(4):965-82

 [8] Tucker DL., Tucker N., Ma Z., Foster JW., Miranda RL., Cohen PS., Conway T., 2003, Genes of the GadX-GadW regulon in Escherichia coli., J Bacteriol 185(10):3190-201

 [9] Yamanaka Y., Oshima T., Ishihama A., Yamamoto K., 2014, Characterization of the YdeO regulon in Escherichia coli., PLoS One 9(11):e111962

 [10] Deng Z., Shan Y., Pan Q., Gao X., Yan A., 2013, Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression., Front Microbiol 4:194

 [11] Hirakawa H., Inazumi Y., Senda Y., Kobayashi A., Hirata T., Nishino K., Yamaguchi A., 2006, N-acetyl-d-glucosamine induces the expression of multidrug exporter genes, mdtEF, via catabolite activation in Escherichia coli., J Bacteriol 188(16):5851-8

 [12] Itou J., Eguchi Y., Utsumi R., 2009, Molecular mechanism of transcriptional cascade initiated by the EvgS/EvgA system in Escherichia coli K-12., Biosci Biotechnol Biochem 73(4):870-8

 [13] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [14] Zwir I., Shin D., Kato A., Nishino K., Latifi T., Solomon F., Hare JM., Huang H., Groisman EA., 2005, Dissecting the PhoP regulatory network of Escherichia coli and Salmonella enterica., Proc Natl Acad Sci U S A 102(8):2862-7

 [15] Ma Z., Masuda N., Foster JW., 2004, Characterization of EvgAS-YdeO-GadE branched regulatory circuit governing glutamate-dependent acid resistance in Escherichia coli., J Bacteriol 186(21):7378-89

 [16] Pesavento C., Hengge R., 2012, The global repressor FliZ antagonizes gene expression by σS-containing RNA polymerase due to overlapping DNA binding specificity., Nucleic Acids Res 40(11):4783-93

 [17] Krin E., Danchin A., Soutourina O., 2010, Decrypting the H-NS-dependent regulatory cascade of acid stress resistance in Escherichia coli., BMC Microbiol 10:273

 [18] Eguchi Y., Oshima T., Mori H., Aono R., Yamamoto K., Ishihama A., Utsumi R., 2003, Transcriptional regulation of drug efflux genes by EvgAS, a two-component system in Escherichia coli., Microbiology 149(Pt 10):2819-28

RegulonDB