![]() ![]() |
Synonyms: MqsA |
Summary:
The antitoxin MqsA belongs to the toxin-antitoxin system MqsR-MqsA, which controls biofilm formation and triggers programmed cell death in E. coli [4]. mqsR is cotranscribed with the downstream gene mqsA, and their respective open reading frames are separated by 1 bp. Contrary to what was reported by Yamaguchi et al. [4], Fraikin et al. reported that MqsA does not regulate biofilm formation and is not a response to stress [3]. Single-cell quantitative measurements show the existence of two cell populations with high or low levels of the MqsA antitoxin that respond differently to environmental stresses [7]. The toxin MqsR functions as an mRNA interferase, that is, it possesses endoribonuclease activity and cleaves mRNA at the specific sequence GCU, 5' or 3' of the G. Elevated levels of free MqsR result in programmed cell death due to the degradation of mRNA and concomitant inhibition of protein synthesis [4]. The antitoxin MqsA has two functions. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||
Evolutionary Family: | CxxCG_CxxCG_HTH, MqsR | ||||||||||||||
TFBs length: | 15 | ||||||||||||||
TFBs symmetry: | inverted-repeat | ||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||
Gene name: | mqsA | ||||||||||||||
Genome position: | 3167851-3168246 | ||||||||||||||
Length: | 396 bp / 131 aa | ||||||||||||||
Operon name: | mqsRA | ||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | csgD, csgE, csgF, csgG, cspD, mqsA, mqsR, rpoS | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
Transcription related (1)
activator (1)
repressor (1)
Accessory Factors Involved in Transport (1)
fimbri, pili (1)
Read more >
|
||||||
Regulated operon(s) | csgDEFG, cspD, mqsRA, nlpD-rpoS | ||||||
First gene in the operon(s) | csgD, cspD, mqsR, rpoS | ||||||
Simple and complex regulons | ArcA,CRP,Fur,GadX,MqsA,ppGpp BasR,BolA,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA,ppGpp BasR,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA CRP,H-NS,MqsA,ppGpp MqsA | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Alignment and PSSM for MqsA TFBSs | ![]() |
---|
Aligned TFBS of MqsA |
---|
Sequence | |
---|---|
AAGCACCTAAAAGGTTAGTTA | |
TATAACCTAAAAGGTTAATTA | |
TCAGACCTTGCAGGTGGGTAA | |
TAAAACCTTAAGGTTAACATT | |
AACCACTTAACAGTACCCTTT | |
GCCAACGATAGATGATAGTTA |
Position weight matrix (PWM). MqsA matrix-quality result |
---|
A 2 4 2 3 6 0 0 1 3 5 3 5 0 0 2 1 4 1 1 1 4 C 0 2 2 2 0 6 4 0 0 0 2 0 0 0 0 1 1 2 0 0 0 G 1 0 1 1 0 0 1 0 0 1 1 1 5 4 0 1 1 3 0 0 0 T 3 0 1 0 0 0 1 5 3 0 0 0 1 2 4 3 0 0 5 5 2 |
Consensus |
---|
; consensus.strict tacaACCtaaaaGGttagtta ; consensus.strict.rc TAACTAACCTTTTAGGTTGTA ; consensus.IUPAC wmmmACCtwamaGKwtasttw ; consensus.IUPAC.rc WAASTAWMCTKTWAGGTKKKW ; consensus.regexp [at][ac][ac][ac]ACCt[at]a[ac]aG[GT][at]ta[cg]tt[at] ; consensus.regexp.rc [AT]AA[CG]TA[AT][AC]CT[GT]T[AT]AGGT[GT][GT][GT][AT] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|