RegulonDB RegulonDB 11.2:Regulon Page
   

UlaR DNA-binding transcriptional repressor

Synonyms: UlaR, UlaR-L-ascorbate 6-phosphate
Summary:
UlaR is a DNA-binding transcription factor of 251 amino acids that is expressed constitutively and that coordinately represses transcription of a divergent operon (ula) involved in transport and utilization of L-ascorbate catabolism [1, 4, 6, 7] Synthesis of these genes is induced when Escherichia coli is grown in the absence of glucose, and under anaerobic conditions it can ferment L-ascorbate; under aerobic conditions it is functional in the presence of casein acid hydrolysate [2, 6, 8] L-Ascorbate-6-P is the effector of the UlaR transcriptional repressor, and when this small molecule binds to UlaR, it severely impairs the formation of UlaR cognate operator sites, since they form a stable complex [9] L-Ascorbate-6-P weakens the affinity of UlaR for DNA and displaces the UlaR oligomer state from a transcription-silencing tetrameric form to a transcription-activating dimeric form [9] UlaR activity is also controlled by homotypic tetramer-dimer transitions regulated by L-ascorbate-6-P [9] UlaR binds to four inverted repeat motifs in the divergent intergenic region ulaG-ulaA and overlaps its target promoters to repress transcription by blocking the interaction of the RNA polymerase with ulaGp and ulaAp [2] Here, the presence of L-ascorbate-6-P breaks this configuration down into DNA-free UlaR homodimers and allows transcription to proceed [9] At concentrations of >2 nM, L-ascorbate-6-P displaces UlaR from its operator site [9] In this system the full repression of the ula regulon requires IHF and binding of UlaR to four operator sites, possibly involving UlaR-mediated DNA loop formation [2] The UlaR transcriptional repressor belongs to the DeoR family, and accordingly, this transcriptional repressor family protein is composed of two domains: an N-terminal HTH domain (residues 1-62), which contains the DNA-binding region [1] and the C-terminal sugar-phosphate-binding domain (residues 69-251), which is responsible for dimerization and inducer binding [10] The C-terminal sugar-phosphate-binding domain belongs to the DeoR-C family of the ISOCOT superfamily and is structurally related to E.
 Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
UlaR Functional   Apo nd nd nd
UlaR-L-ascorbate 6-phosphate Non-Functional   Holo nd nd nd
Evolutionary Family: DeoR
TFBs length: 20
TFBs symmetry: inverted-repeat
Connectivity class: Local Regulator
Gene name: ulaR
  Genome position: 4417698-4418453
  Length: 756 bp / 251 aa
Operon name: ulaR
TU(s) encoding the TF:
Transcription unit        Promoter
ulaR
 


Regulon       
Regulated gene(s) ulaA, ulaB, ulaC, ulaD, ulaE, ulaF, ulaG
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Phosphotransferase Systems (PEP-dependent PTS) (3)
unassigned reversible reactions (2)
carbon compounds (1)
carbon utilization (1)
Regulated operon(s) ulaABCDEF, ulaG
First gene in the operon(s) ulaA, ulaG
Simple and complex regulons CRP,IHF,UlaR
IHF,UlaR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[UlaR,-](2)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  UlaR repressor ulaAp Sigma70 -44.5 -97.5 ulaA, ulaB, ulaC, ulaD, ulaE, ulaF
ggtcgcgtcaCATTTAATCATAAATAATCTtgttgtgatt
 4419873 4419892 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-DAP-SEQ], [EXP-GSELEX], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [1], [2], [2], [3], [3], [4], [5]
  UlaR repressor ulaAp Sigma70 -19.5 -72.5 ulaA, ulaB, ulaC, ulaD, ulaE, ulaF
aatcttgttgTGATTACTTTTGAAAATTAGagtgagtgca
 4419898 4419917 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-DAP-SEQ], [EXP-GSELEX], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [2], [2], [3], [3], [4], [5]
  UlaR repressor ulaGp nd -0.5 -50.5 ulaG
aatagtgtcaGGATTAATCAAAACCAATCAcatattgatt
 4419666 4419685 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-DAP-SEQ], [EXP-GSELEX], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [2], [2], [3], [3], [5]
  UlaR repressor ulaGp nd 25.5 -25.5 ulaG
aatcacatatTGATTCGAATTGAACTATCAtgaaggtaaa
 4419641 4419660 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-DAP-SEQ], [EXP-GSELEX], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [2], [2], [3], [3], [5]


Alignment and PSSM for UlaR TFBSs    

Aligned TFBS of UlaR   
  Sequence
  TGATTGGTTTTGATTAATCCTGA
  TGATTCGAATTGAACTATCATGA
  AGATTATTTATGATTAAATGTGA
  TGATTACTTTTGAAAATTAGAGT

Position weight matrix (PWM). UlaR matrix-quality result    
A	1	0	4	0	0	2	0	1	1	1	0	0	4	2	1	3	3	1	1	1	1	0	3
C	0	0	0	0	0	1	1	0	0	0	0	0	0	0	1	0	0	0	2	1	0	0	0
G	0	4	0	0	0	1	2	0	0	0	0	4	0	0	0	0	0	0	0	2	0	4	0
T	3	0	0	4	4	0	1	3	3	3	4	0	0	2	2	1	1	3	1	0	3	0	1

Consensus    
;	consensus.strict             	tGATTagtttTGAataatcgtGa
;	consensus.strict.rc          	TCACGATTATTCAAAACTAATCA
;	consensus.IUPAC              	tGATTvstttTGAwyaatcstGa
;	consensus.IUPAC.rc           	TCASGATTRWTCAAAASBAATCA
;	consensus.regexp             	tGATT[acg][cg]tttTGA[at][ct]aatc[cg]tGa
;	consensus.regexp.rc          	TCA[CG]GATT[AG][AT]TCAAAA[CG][CGT]AATCA

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-DAP-SEQ] high throughput DNA Affinity Purification (DAP) Sequencing

 [EXP-GSELEX] high throughput Genomic SELEX-chip evidence

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Campos E., Aguilar J., Baldoma L., Badia J., 2002, The gene yjfQ encodes the repressor of the yjfR-X regulon (ula), which is involved in L-ascorbate metabolism in Escherichia coli., J Bacteriol 184(21):6065-8

 [2] Campos E., Baldoma L., Aguilar J., Badia J., 2004, Regulation of expression of the divergent ulaG and ulaABCDEF operons involved in LaAscorbate dissimilation in Escherichia coli., J Bacteriol 186(6):1720-8

 [3] Shimada T., Ogasawara H., Ishihama A., 2018, Single-target regulators form a minor group of transcription factors in Escherichia coli K-12., Nucleic Acids Res 46(8):3921-3936

 [4] Zhang Z., Aboulwafa M., Smith MH., Saier MH., 2003, The ascorbate transporter of Escherichia coli., J Bacteriol 185(7):2243-50

 [5] Baumgart LA, Lee JE, Salamov A, Dilworth DJ, Na H, Mingay M, Blow MJ, Zhang Y, Yoshinaga Y, Daum CG, O'Malley RC, 2021, Persistence and plasticity in bacterial gene regulation., Nat Methods, 18(12):1499 10.1038/s41592-021-01312-2

 [6] Campos E., Montella C., Garces F., Baldoma L., Aguilar J., Badia J., 2007, Aerobic L-ascorbate metabolism and associated oxidative stress in Escherichia coli., Microbiology 153(Pt 10):3399-408

 [7] Hvorup R, Chang AB, Saier MH, 2003, Bioinformatic analyses of the bacterial L-ascorbate phosphotransferase system permease family., J Mol Microbiol Biotechnol, 6(3-4):191 10.1159/000077250

 [8] Yew WS., Gerlt JA., 2002, Utilization of L-ascorbate by Escherichia coli K-12: assignments of functions to products of the yjf-sga and yia-sgb operons., J Bacteriol 184(1):302-6

 [9] Garces F., Fernandez FJ., Gomez AM., Perez-Luque R., Campos E., Prohens R., Aguilar J., Baldoma L., Coll M., Badia J., Vega MC., 2008, Quaternary structural transitions in the DeoR-type repressor UlaR control transcriptional readout from the L-ascorbate utilization regulon in Escherichia coli., Biochemistry 47(44):11424-33

 [10] Anantharaman V, Aravind L, 2006, Diversification of catalytic activities and ligand interactions in the protein fold shared by the sugar isomerases, eIF2B, DeoR transcription factors, acyl-CoA transferases and methenyltetrahydrofolate synthetase., J Mol Biol, 356(3):823 10.1016/j.jmb.2005.11.031

 [11] Amouyal M, 2005, Gene regulation at-a-distance in E. coli: new insights., C R Biol, 328(1):1 10.1016/j.crvi.2004.10.002


RegulonDB